Ribosomal 16S DNA library prep we offer:
- An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Fadrosh DW et. al. Microbiome. 2014 Feb 24;2(1):6. doi: 10.1186/2049-2618-2-6. https://www.ncbi.nlm.nih.gov/pubmed/24558975
| Prep. type | Min. amount | Recommend amount | Max. volume | Accepted buffers |
|---|---|---|---|---|
| DNA for 16S prep |
200 ng per sample Min. 10 ng/μl in 20 μl |
200 - 2000 ng |
100 μl |
10 mM Tris |
Input requirements for ribosomal 16S DNA library preps.
Submission: Samples for 16S prep must be submitted in 96-well plates, with up to 94 samples per plate (to allow us to add positive and negative controls during amplification).
The user is responsible for ensuring submitted DNA samples contain sufficient microbial DNA. If unsure of this, please contact us and we can perform a small test with a few samples. Although we will attempt to re-prep any samples that fail in a first round of library preparation, we cannot promise successful library prep for all samples, and will contact you in the case samples do not amplify before proceeding to sequencing.
Protocol: We use the Fadrosh et al. (Microbiome. 2014 Feb 24;2(1):6. doi: 10.1186/2049-2618-2-6.) protocol to prepare amplicon libraries of the V3-V4 region of the prokaryotic 16S rRNA gene. This region can be used to characterize the microbial diversity on genus or species levels in e.g. clinical samples or other sample types, containing sufficient microbial DNA. The procedure employs the 319F and 806R primers, but incorporate the modified 806R recommended by the Earth Microbiome Project, thus the 16S amplification primer sequences are as follows:
319F forward primer: 5’ ACTCCTACGGGAGGCAGCAG 3’
806R reverse primer: 5’ GGACTACNVGGGTWTCTAAT 3’
The libraries contain in-read dual indexes and heterogeneity spacers, enabling multiplexing of up to 570 samples and sequencing on MiSeq 300 bp paired end reads with only 10% PhiX spike-in. Up to 190 samples are recommended to be sequenced on one Miseq run. A positive control sample (ZymoBIOMICS Microbial Community DNA standard II, Zymo Research) and a negative control sample (H2O) will always be included.
Data: We will provide demultiplexed files from read 1 and read 2 for each sample in fastq, and upon request and for an additional fee, QIIME2 or MOTHUR analysis reports.
We employ normalization to achieve even yields from all samples, but are unable to guarantee read thresholds per sample except by prior arrangement, which may entail additional costs. Unless agreed in advance, runs delivering >10,000 reads (for 94 or fewer samples per run – proportionally lower if more samples) for 95% of submitted samples will be considered successful and additional sequencing will only be performed at the user’s expense.
Sample amounts
As a general rule, more DNA is better, so please provide more than the recommended sample amounts listed in the table above if you can. Using the minimum amount increases the chances of failed preps. We may also be willing to attempt library preparation with amounts lower than the given minima, but this must be agreed with us in advance of submission, and you must nonetheless pay the cost of consumed reagents in the event of prep failure.
Accepted buffers
See table. We do not accept lyophilized or precipitated samples. Samples delivered in inappropriate buffers will either be returned to the user or subject to additional cleanup costs of 1000 NOK/sample at our discretion.